PCR

Data Input & Configuration Options

Sequence
database
Primer Forward:
Reverse:
Condition Max product size:
Min perfect match:   Min good match:
   





HELP: Parameters

  • Max product size
  • Maximum size of amplified region.

  • Min perfect match
  • Number of bases that match exactly on 3' end of primers. Minimum match size is 15.

  • Min good match
  • Number of bases on 3' end of primers where at least 2 out of 3 bases match.

  • Flip reverse primer
  • Invert the sequence order of the reverse primer and complement it.




Output sample

Amplified Sequences

Output
>chr13,32817204..32817398,(+),195bp,TTCTTCATCTGCTCTTTGTATTCCT|AATGGAAGCTCTGAGAGTCAAGAT
TTCTTCATCTGCTCTTTGTATTCCTCAACATATGGAACAGCCAACTGCCTCAGCTGCTCC
AGACGCTCAACAAGCTTAGCGCGCACAGACTCCACAATGGGCATCAGGGCGGCCTTGGTC
TCCTCCACATTGGCGGCCATCTTCTGACGCAGCTCTGCCACCACGGGCTCCATCTTGACT
CTCAGAGCTTCCATT

Primer Melting Temperatures

Forward 59.8 C TTCTTCATCTGCTCTTTGTATTCCT
Reverse 59.9 C AATGGAAGCTCTGAGAGTCAAGAT